Pseudogenes & Mutation analysis

April 7th, 2016 |

Pseudogenes of ABCD1 and the importance for genetic analysis

Stephan Kemp, Ph.D

In most cases, ALD is diagnosed biochemically by measuring elevated levels of very long-chain fatty acids (VLCFA) in plasma. This measurement is highly reliable for the diagnosis of male patients. However, care should be taken when VLCFA measurement is used for the identification of females suspected for ALD. Approximately 20% of women with ALD have normal VLCFA levels. A normal VLCFA level thus does not exclude the diagnosis ALD in females.

Mutational analysis of the ABCD1 gene has the potential to identify women who are heterozygous for ALD with virtually complete accuracy. However, the fact that about half of the mutations are pedigree-specific requires screening of the entire gene in an affected male (or obligate carrier) prior to targeted carrier testing for at-risk female relatives.
FISH analysis showing the pseudogenes

The gene mutated in ALD (ABCD1) is located on the X-chromosome at location Xq28. The ABCD1 gene contains 10 exons and covers approximately 21 kb. Sequence analysis of genomic DNA is made difficult because of the presence of ABCD1 paralogs on four autosomes (Figure). At some moment in primate evolution (about 5-10 million years ago), a 9.7 kb DNA segment encompassing exons 7 through 10 of the ABCD1 gene was duplicated from the X-chromosome to the chromosomes 2 (2p11), 10 (10p11), 16 (16p11) and 22 (22q11). In 1997, Eichler and colleagues at the Human Genome Center (Livermore, Ca) performed comparative sequence analysis of this fragment and showed that these four paralogs share 92-96% nucleotide identity. For details, please follow this link.
Picture taken from Eichler et al. Interchromosomal duplications of the adrenoleukodystrophy locus: a phenomenon of pericentromeric plasticity. (1997) Hum Mol Genet 6: 991-1002.

Because of this very high homology between the pseudogenes and the ABCD1 gene, great care should be taken when mutation analysis using genomic DNA is set up. In 1999, Corinne Boehm and colleagues from the Institute of Genetic Medicine at Johns Hopkins University (Baltimore, MD) developed and validated a robust genomic DNA-based diagnostic test for ALD. Xq28, ABCD1 gene specific primers were designed (see list below) that allow accurate mutation analysis without interference of the pseudogenes. For more details, please follow this link, or contact us for a copy of the paper.

Below, alignments of the exons 7, 8, 9 and 10 of the ABCD1 gene (Xq28) and the four paralogs on chromosomes 2, 10, 16 and 22 are shown. The asterisks indicate identical nucleotides in all five sequences.

Alignment of exon 7 of the ABCD1 gene with the paralogs.

chr2            GCCCTACATGTCTGTGGGTTCCTTGTGTGACCAGGTGATCTACCCGGACTCAGTGGAGGG 60
chr10           GCCCTACATGTCTGTGGGATCCCTGCGTGACCAGGTGATCTACCCGGACTCAGTGGAGGA 60
chr16           GCCCTACATGTCTGTGGGTTCCCTGCGTGACCAGGTGACCTACCCGGACTCAGTGGAGGA 60
chr22           GCCCTACATGTCTGTGGGTTCCCTGCATGACCAGGTGATCTACCCGGACTCAGTGGAGGA 60
ABCD1           GCCCTACATGTCTGTGGGCTCCCTGCGTGACCAGGTGATCTACCCGGACTCAGTGGAGGA 60
                ****************** *** **  *********** ******************** 

chr2            CATGCGAAGGAAGGGCTACCCGGAGCAGGACCTGGAAGCCATCCTGGACATCGTGCACCT 120
chr10           CATGCGAAGGAAGGGCTACTCGGAGCAGGACCTGGAAGCCATCCTGGATATCGTGCACCC 120
chr16           CATGCGAAGGAAGGGCTACTCAGAGCAGGACCTGGAAGCCATCCTGGACATCATGCACCT 120
chr22           CATGCGAAGGAACGGCTACTCGGAGCAGGACCTGGAAGCCATCCTGGACATCGTGCACCC 120
ABCD1           CATGCAAAGGAAGGGCTACTCGGAGCAGGACCTGGAAGCCATCCTGGACGTCGTGCACCT 120
                ***** ****** ****** * **************************  ** ****** 

chr2            GCACCACATCCTGCAGTGGGAGGGAG 146
chr10           ACACCACATCCTGCAGTGGGAGGGAG 146
chr16           GCACCACATCCTGCAGCGGGAGGGAG 146
chr22           GCACCACACCCTGCAGCGGGAGGGAG 146
ABCD1           GCACCACATCCTGCAGCGGGAGGGAG 146
                 ******* ******* *********

Alignment of exon 8 of the ABCD1 gene with the paralogs.

chr2            GTTGGGAGGCTATGTGTGACTGGAAAGATGTCCTGCCGGGTGGCGAGAAGCAGAGAATCG 60
chr10           GTTGGGAGGCTATGTGTGACTGGAAGGACATCCTGCCAGGTGGTGAGAAGCAGAGAATCG 60
chr16           GTTGGGAGGCTATGTGTGACTGGAAGGACGTCCTGCCGGGTGGCAAGAAGCAGAGAATCG 60
chr22           GTTGGGAGGCTATGTGTGACTGGAAGGACGTCCTGCCGGGTGGCAAGAAGCAGAGAATCG 60
ABCD1           GTTGGGAGGCTATGTGTGACTGGAAGGACGTCCTGTCGGGTGGCGAGAAGCAGAGAATCG 60
                ************************* **  ***** * *****  ***************

chr2            GCATGGCCCGCATGTTCTGCCACAG 85
chr10           GCATGGCCCGCATGTTCTACCACAG 85
chr16           GCATGGCCTGCATGTTCTACCACAG 85
chr22           GCATGGCCTGCATGTTCTACCACAG 85
ABCD1           GCATGGCCCGCATGTTCTACCACAG 85
                ******** ********* ******

Alignment of exon 9 of the ABCD1 gene with the paralogs.

chr2            GCCCAAGTACGCCCTCCTGGATGAATGCACCAGTGCTGTGAGCATCGACGTGGAAGGCAA 60
chr10           GCCCAAGTACGCCCTCCTGGATGAAGGCACCAGTGCCGTGAGCATCGACGTGGAAGGCAA 60
chr16           GCCCAAGTACACCCTCCTGGATGAATGCACCAGTGCCATGAGCATCGACGTGGAAGGCAA 60
chr22           GCCCAAGTACACCCTCCTGGATGAATGCACCAGTGCCATGAACATCGACGTGGAAGGCAA 60
ABCD1           GCCCAAGTACGCCCTCCTGGATGAATGCACCAGCGCCGTGAGCATCGACGTGGAAGGCAA 60
                ********** ************** ******* **  *** ******************

chr2            GATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCAGCCCTC 120
chr10           GATCTTCCAGGTGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCTCCAGCCCTC 120
chr16           GATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTC 120
chr22           GATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTC 120
ABCD1           GATCTTCCAGGCGGCCAAGGACGCGGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTC 120
                *********** ************ ************************* ** ******

chr2            C-TGTG 125
chr10           CCTGTG 126
chr16           CCTGTG 126
chr22           CCTGTG 126
ABCD1           CCTGTG 126
                * ****

Alignment of exon 10 of the ABCD1 gene with the paralogs.

chr2            GGAGTACCACACACACTTGCTACAGTTCGATGGGGAGGGTGGCTGGAAGTTCGAGAAGCT 60
chr10           GGAGTACCACACACACTTGCTACAGTTCGATGGGGAGGGTGGCTGGAAGTTCGAGAAGCT 60
chr16           GGAGTACCACACACACTTGCTACAGTTCGATGGGGAGGGCGGCTGGAAGTTCGAGAAGCT 60
chr22           GGAGTACCACACACACTTGCTACAGTTCGATGGGGAGGGCGGCTGGAAGTTCGAGAAGCT 60
ABCD1           GAAATACCACACACACTTGCTACAGTTCGATGGGGAGGGCGGCTGGAAGTTCGAGAAGCT 60
                * * *********************************** ********************

chr2            AGGCTCGGCTGCCCGCCTGAGCCTGACAGAGGAGAAGCAGCGGCTGGAGCAGCAGCTGGC 120
chr10           GGACTCAGCTGCCCACCTGAGCCTGACAGAGGAGAAGCAGCGGCTGGAGCAGCAGCTGGC 120
chr16           GGACTCAGCGGCCAGCCTGAGTCTGACAGAGGAGAAACAGCGGCTGGAGCAGCAGCTGGC 120
chr22           GGACTCAGCGGCCCGCCTGAGTCTGACAGAGGAGAAGCAGCGGCTGGAGCAGCAGCTGGC 120
ABCD1           GGACTCAGCTGCCCGCCTGAGCCTGACGGAGGAGAAGCAGCGGCTGGAGCAGCAGCTGGC 120
                 * *** ** ***  ****** ***** ******** ***********************

chr2            GGGCATTCCCAAGATGCAGCGGCACCTCCAGGAGCTCTGCCAAATCCTGGGCGAGGCCGT 180
chr10           GGGCATTCCCAAGATGCAGCGGCACCTCCAGGAGCTCTGCCAAATCCTGGGCGAGGCCGT 180
chr16           AGGCATTCCCAAGATGCAGCGGCACCTCCAGGAGCTCTGCCAAATCCTGGGCGAGGCCGT 180
chr22           AGGCATTCCCAAGATGCAGCGGCACCTCCAGGAGCTCTGCCAAATCCTGGGCGAGGCCGT 180
ABCD1           GGGCATTCCCAAGATGCAGCGGCGCCTCCAGGAGCTCTGCCAGATCCTGGGCGAGGCCGT 180
                 ********************** ****************** *****************

chr2            GGCCCCAGCGCACGTGCCGGCACCTAGCCCGCAAGGCCCTGGTGGCCTCCAGGGTGCCTC 240
chr10           GGCCCCAGCGCACGTGCCGGCACCTAGCCTGCAAGGCCCTGGTGGACTCCAGGGTGCCTC 240
chr16           GGCCCCAGCGCATGTGCCGGCACCTAGCCCGCAAGGCCCTGGTGGCCTCCAGGGTGCCTC 240
chr22           GGCCCCAGCGCATGTGCCGGCACCTAGCCCGCAAGGCCCTGGTGGCCTCCAGGGTGCCTC 240
ABCD1           GGCCCCAGCGCATGTGCCGGCACCTAGCCCGCAAGGCCCTGGTGGCCTCCAGGGTGCCTC 240
                ************ **************** *************** **************

chr2            CACCTGA 247
chr10           CACCTGA 247
chr16           CACCTGA 247
chr22           CACCTGA 247
ABCD1           CACCTGA 247
                *******

ABCD1 gene specific primers

Exon/s Primer name 5′ -> 3′ Sequence Primer length Amplicon size (incl M13 tails)
1a ALDe1A-F TGTAAAACGACGGCCAGTACAACAGGCCCAGGGTCAGA 38 458 bp
ALDe1A-R CAGGAAACAGCTATGACCAGGAAGGTGCGGCTCACCA 37
1b ALDe1B-F TGTAAAACGACGGCCAGTAACCGGGTATTCCTGCAGCG 38 421 bp
ALDe1B-R CAGGAAACAGCTATGACCACTGGTCAGGGTTGCGAAGC 38
1c ALDe1C-F TGTAAAACGACGGCCAGTCCACGCCTACCGCCTCTACTT 39 520 bp
ALDe1C-R CAGGAAACAGCTATGACCAGACTGTCCCCACCGCTC 36
2 ALDe2-F TGTAAAACGACGGCCAGTGGCACTGGGAGACCCTG 35 368 bp
ALDe2-R CAGGAAACAGCTATGACCTCAGCACCCAGCGGTATGG 37
3 and 4 ALDe3/4-F TGTAAAACGACGGCCAGTGCAGAAGAGCCTCGCCTTTC 38 606 bp
ALDe3/4-R CAGGAAACAGCTATGACCGCAGCAGGTCAGCACCTGCA 38
5 ALDe5-F TGTAAAACGACGGCCAGTCTGCCAGGGATGGGAATGAG 38 373 bp
ALDe5-R CAGGAAACAGCTATGACCTCTCACCTTGACCTTGGCCC 38
6 ALDe6-F TGTAAAACGACGGCCAGTGCCATAGGGTACGGGAAGGG 38 312 bp
ALDe6-R CAGGAAACAGCTATGACCGCCTCTGCAGGAAGCCATGT 38
7 ALDe7-F TGTAAAACGACGGCCAGTCGATCCACTGCCCTGTTTTGG 39 527 bp
ALDe7-R CAGGAAACAGCTATGACCCTTCCCTAGAGCACCTGG 36
8 and 9 ALDe8/9-F TGTAAAACGACGGCCAGTCTGAGCCAAGACCATTGCCCCCG 41 507 bp
ALDe8/9-R CAGGAAACAGCTATGACCTGCTGCTGCCGGGCCCGC 36
10 ALDe10-F TGTAAAACGACGGCCAGTGAGGGGAGGAGGTGGCCTGGC 39 463 bp
ALDe10-R CAGGAAACAGCTATGACCGCGGGGTGCGTGCATGGGTGG 39

Primer sequences in black are M13F and M13R sequences that are used for sequencing.
Nucleotides in green are Xq28, ABCD1 gene, specific.

Primers were taken from Boehm et al: Accurate DNA-based Diagnostic and Carrier Testing for X-linked Adrenoleukodystrophy (1999) Mol Genet Metab 66: 128-136.

afbeelding van de Engelse vlag English    afbeelding van de Nederlandse vlag Nederlands    afbeelding van de Franse vlag Français   afbeelding van de Spaanse vlag Español   afbeelding van de Duitse vlag Deutsch